*For offprint requests: tel (515)294-8988, fax (515)294-6019, email randrews@iastate.edu

SUMMARY

Tn916 is a broad host range conjugal transposon, originally isolated from Enterococcus faecalis, that encodes tetracycline resistance (tet M). In addition to being self-transmissible, Tn916 has the ability to mobilize non-self-transmissible genetic elements, such as plasmids or chromosomal genes. Tn916 transfer between Bacillus subtilis and Bacillus thuringiensis subsp. israelensis was evaluated over various conditions of soil moisture, temperature, pH and available nutrients. It was also shown that Tn916-like conjugal elements in swine waste isolates were capable of transfer to a Bacillus recipient in a soil environment. These results suggest that Tn916-mediated genetic exchange between bacteria may facilitate transfer of antibiotic resistance determinants as well as other nonconjugal DNA in the soil environment.

INTRODUCTION

Recently, there has been increasing interest in gene transfer and acquisition of antibiotic resistance in the environment. Particular emphasis has been placed on genetically engineered microorganisms (GEMS) released into the environment. One concern is that when a GEM is introduced into the environment, the engineered DNA may be acquired by resident microbes resulting in disruption of the ecosystem homeostasis. This may be particularly significant if the newly acquired DNA provides a selectable advantage to the recipient (15).

In nature, the most important method by which bacteria exchange DNA seems to be conjugation (18). A wide range of bacterial genera have been shown to participate in conjugative genetic exchange. Conjugation requires a series of genes that encode conjugal functions. In Gram-positive bacteria, particularly within the genera Streptococcus and Enterococcus, conjugal genes have been shown to frequently occur on plasmids as well as transposons (2). In addition to encoding conjugal functions, these elements often carry antibiotic resistance genes, as well as genes encoding resistance to heavy metals and bacteriocin production.

Tn916 was originally isolated from Enterococcus faecalis and encodes resistance to tetracycline, tetM (4). Tn916 has been shown to conjugally transfer to a wide variety of recipients, both Gram-positive and Gram-negative. Thus, this element spreads tetracycline resistance to susceptible recipients. In addition to the ability to conjugally transfer, Tn916 induces mobilization of other nonconjugal genetic elements (11, 16). Therefore, when Tn916 is present in a donor cell, other resident plasmids, which may carry additional resistance genes, may also be transferred to the recipient. Showsh and Andrews further showed that the frequency of Tn916-mediated transfer is increased in the presence of tetracycline (13). Therefore, Tn916 may be a factor in gene transfer in the environment as well as in the dissemination of nonconjugal DNA from GEMs.

In the laboratory, Tn916-matings are usually done on nitrocellulose membranes (10). Presumably, the matrix of the membrane serves as a medium that brings the cells into contact so DNA transfer can occur. Because there has been some suggestion of Tn916 conjugal activity in soil (12), it is feasible that soil particles may provide the same function as a membrane. Once in the soil, Tn916- mediated conjugation may be functional only within a certain range of the diverse conditions encountered in the soil environment. However, if it is conjugally active within this ecosystem, Tn916 could add the fluidity to the gene pool necessary to allow dissemination of nonconjugal DNA.

The greatest impact on genetic mobility in the soil may occur in agricultural fields fertilized with animal waste. The ubiquitous nature of E. faecalis in mammalian fecal material make this microbe a likely vector for the delivery of conjugal elements to soil populations. The goal of the research presented herein was to explore the possibility of Tn916-mediated genetic exchange in the soil environment.

MATERIALS AND METHODS

Bacterial strains and media. The Bacillus donor used in experiments to detect transposon transfer was Bacillus subtilis AN861 (Chr::Tn916) (11). The donor used in Enterococcus matings was Enterococcus faecalis CG110 (chr::Tn916) (5). Both donors are therefore resistant to tetracycline (10 µg/ml). In experiments detecting plasmid transfer, B. subtilis AN883 [chr::Tn916, pC194 (Cm^r, 10 µg/ml)] was used as the donor (Naglich and Andrews, 1988b). The recipient in all cases was B. thuringiensis subspecies israelensis AN142, (Neo^r, 200 µg/ml) (10).

Culture growth was on Luria-Burtani medium (LB) (9). Cultures of donor and recipient were grown in 100 ml of LB broth at 30C on a rotary shaker at 250 rpm, agar plates of LB medium contained 1.5% agar (Difco, Detroit, MI). Selection for donor, recipient and conjugant populations were on LB agar plates with appropriate selection. When native (nonsterile) soil was used in mating experiments, agar media was supplemented with 50 µg/ml nystatin and 100 µg/ml cycloheximide to control fungal growth. All antibiotics were obtained from Sigma Chemical Company (Sigma, St. Louis, MO).

Soil. The soil used in all experiments was a fine sandy-loam (Typic Hapludolls) obtained from the upper 30 cm of a soybean field 1.8 miles southeast of Ames, Iowa. The sample was sieved through a 1 cm screen to remove debris and stored at 4C until used. The soil had an initial pH of 7.4 and an organic matter of 1.8%. The water content of the soil at 33 Kpa was determined to be 7.5% (v/w). The texture of the test soil was also determined (93.5% sand, 1.2% course silt, 1.3% fine silt, 4.0% clay). The standard conditions used for these experiments were 7.5% moisture (v/w), pH 7.4 (the pH of the soil as obtained) and incubation at 30C, 24 h prior to, as well as during the mating, unless otherwise specified.

To alter the moisture content of the soil, varying amounts of sterile distilled water were added to soil samples that had been previously dried to constant weight. The moisture of a series of samples was varied to a range from 2-13% (v/w). When effect of temperature on conjugation was studied, the soil samples were incubated at the experimental temperature 24 h prior to inoculation, as well as during the mating. To amend the nutrient content of the soil, powdered brain-heart infusion (Difco) was added to sterile distilled water used for moisture adjustment. The amount of nutrients added varied from 0.5 to 2.5 mg/g of soil. For adjustment of soil pH, samples were amended with either Ca(OH)₂ or Al₂(SO₄)₃ (Fisher Scientific, Fair Lawn, New Jersey). After pH adjustment, soil samples were held at 4C for two weeks prior to inoculation. The pH of each sample was then determined at the time of inoculation. The final pH of the soil sampes ranged from 3.9 to 9.2.

Matings performed in the presence of DNase were supplemented with a solution of DNase (Sigma) in sterile water to a final concentration of 40 mg of DNase per gram of soil.

Mating procedure. To prepare the test soil for a mating experiment, samples were air-dried for seven days at room temperature and dispensed into 250 ml flat-bottom centrifuge bottles (100 g per bottle). For procedures using sterile soil, the samples (in centrifuge bottles) were autoclaved twice for two hours

with an overnight cool-down period between sterilization cycles. Once sterile, the water content was adjusted to 7.5% with sterile water 24 h prior to inoculation. Any amendments to the soil were made at this point. The samples were then held at 30C overnight before inoculation.

Liquid cultures of donor and recipient were used to inoculate the soil (in 250 ml bottles). For inoculation, 1 ml of the recipient culture was added to the soil followed immediately by 1 ml of the donor; after inoculation, each bottle contained approximately 1 x 10⁷ CFU of donors and/or recipients. Bottles containing inoculated soil were rolled gently for five minutes to mix the inoculum and incubated at 30C for 24 h. After incubation, the bacteria were recovered from the soil by adding 50 ml of sterile LB broth and gently shaking the sample. Aliquots were then spread onto LB agar plates with appropriate selection. After an overnight incubation, the colonies were enumerated and results expressed in terms of conjugants per output donor. All transfer frequencies presented here represent the average of three independent mating experiments (unless otherwise specified).

Isolation of enterococci. An outflow sample was obtained from an Iowa State University hog farrowing house. The sample was diluted and pour plates were prepared. To determine total culturable bacteria, brain heart infusion agar (BHI) (Difco, Detroit, MI) was used. For total culturable tetracycline resistant bacteria, the BHI was supplemented with 10 µg/ml tetracycline (Sigma Chemical Company, St. Louis, MO). For enumeration and isolation of enterococci, pour plates were prepared with KF Streptococcus agar (KF) (Difco). This medium was supplemented with 10 µg/ml tetracycline to isolate tetracycline resistant (Tet^r) enterococci. Incubation of all plates was at 37C for 48 h. From the KF (Tet) agar plates, 100 typical Tet^r enterococci were selected for conjugal studies and confirmed to be enterococci by the method of Knudtson and Hartman (6, 7).

Southern hybridization and PCR analysis. Genomic DNA was prepared from conjugants for Southern hybridization. Isolation of the DNA was by use of a Quiagen Genomic Tip (Quiagen, Castsworth, CA). Restriction digestion of the genomic DNA was carried out with the enzyme HincII by using the conditions recommended by the manufacturer (New England Biolabs, Beverly, MA). The digested genomic extracts were analyzed by gel electrophoresis on a 0.8% (w/v) agarose gel. After electrophoresis, the gel was stained with ethidium bromide, and the DNA was visualized on a UV transilluminator. The DNA was blotted by the method of Southern et al. (14). Hybridization was with a plasmid probe consisting of [³²P]-dATP-labeled pAM120, which contains Tn916, by the method of Naglich and Andrews (11). Results were visualized by autoradiography.

The polymerase chain reaction (PCR) primers utilized in the detection of Tn916-like sequences, were developed from the known sequence of Tn916 (3) by use of the Rightprimer PCR primer selection program (Biodisk, San Francisco, CA). The primers were synthesized by the Iowa State University nucleic acids facility (Ames, IA) and represent the following sequences:

Primer #1: 5'- TGCCGACTTAACAAGCCCC -3'

Primer #2: 5'- TTGTAATGGAATCAACCGTCCCC -3'

The primers amplify a 715 bp fragment within ORF 13 of Tn916. The assay made use of the GeneAmp PCR kit and Perken Elmer 9600 thermal cycler (Perkin Elmer, Roche Molecular Systems, Inc., Branchburg, New Jersey). Conjugant genomic DNA, as prepared previously, was used in the assay. The thermal cycler was programmed as follows: 94C, 1 min; (25 cycles of the following) 94C, 1 min; 50C, 1 min; 72C, 2 min; followed by 72C, 7 min, for final extension of the templates. The product was loaded onto a 1.8% (w/v) agarose gel for electrophoresis and stained with ethidium bromide for visualization.

RESULTS

Tn916 transfer in sterile soil. The initial matings performed were between B. subtilis AN861 and B. thuringiensis subsp. israeliensis under standard conditions. In a sterile soil environment, transfer of Tn916 was observed at an average frequency of 2.1 x 10^-5 conjugants per donor. To assure that the putative conjugants did not result from spontaneous mutation, soil inoculated with only donor or recipient was subjected to the appropriate selection pressure upon recovery from the soil; mutation to double antibiotic resistance was not detected in any mating performed. The rate of spontaneous mutation is, therefore, well below the level of detection for this procedure.

To assess the ability of Tn916 to mobilize plasmid DNA during conjugation in soil, B. subtilis AN883 (chr::Tn916, pC194) was mated with B. thuringiensis AN142 in sterile soil. The soil conditions were as previously described for the detection of Tn916 transfer (standard conditions). Transfer of the transposon and pC194 was observed at an average frequency of 1.97 x 10^-6 conjugants per donor.

To confirm that the genetic exchange observed was the result of conjugation and not transformation, all matings were repeated in the presence of DNase. The incorporation of DNase into the soil had essentially no effect on the mating. To assure DNase remained active in the soil environment, a sample of plasmid pUC19 (5 µg) was mixed with 10 mg of soil and incubated at 37C for 30 min. After this incubation, samples mixed with soil containing the enzyme were extensively degraded whereas intact plasmid was isolated from samples to which no DNase was added (data not shown).

Environmental parameters. To determine if Tn916-mediated genetic exchange occured over the range of conditions present in the environment, conjugal transposition was examined over various conditions of moisture, pH, nutrient availability and temperature.

The moisture content of several soil samples was adjusted so a range of moistures between 2 and 13% was represented. The data from these matings is presented in Figure 1. Interestingly, lower soil moisture content resulted in higher transfer frequencies. Transfer of Tn916 at 2-3% water content consistently resulted in frequencies 3 to 4 times that obtained at higher moistures. Importantly, it should be noted that transfer was detected at all moisture values tested.

The nutrient content of a soil can vary widely from point to point even over a relatively short distance. To evaluate the effect of various amounts of nutrients on conjugation, donor and recipient cultures were inoculated into soil samples with amended nutrient contents. The results from these experiments are shown in Figure 2. Conjugation was detected over the entire range of amendments but the frequency of transfer increased as nutrient amendment increased. Frequencies rose from 1.9 x 10^-5 in natural soil (unamended) to 4.2 x 10^-5 in soil amended with 2.5 mg of BHI per gram of soil.

The temperature in the upper few centimeters of a soil vary considerably depending on time of the year and meteorological conditions. Figure 3 shows transfer frequencies resulting from alterations to the incubation temperature of the mating. The incubation temperature was varied to more closely represent the seasonal changes in topsoil temperature that may occur in a natural environment. These results showed detectable frequencies of Tn916 transfer only between 18 and 35C with an optimum occurring at 30C. The optimum temperature resulted in a frequency 3 times that at any other temperature tested. It is important to note that 30C is the optimal temperature for the growth of many Bacillus species.

Soil pH is a parameter that may be quite variable depending on the type of soil and site chosen. To assess the ability of Tn9l6 to transfer in soils of various pH, a series of soil samples with altered pH values were inoculated with donor and recipient (Fig. 4). Conjugation was only detected in the range of pH from 5.95 to 8.83. Outside of this range, transfer frequencies fell below detectable levels. The data represents the result of 30 independent matings in samples of test soil with amended pH values.

Nonsterile matings. Krasovsky and Stotsky showed evidence that in Escherichia coli conjugation, frequency of plasmid transfer was higher in sterilized soil than in nonsterile soil (8). Because the soil system presented herein uses sterile soil, the resulting frequencies may differ from those that would occur in a natural soil environment. To better understand the role of soil microflora and enzymatic composition on Tn916-mediated conjugal transfer, parallel matings were performed in native as well as sterile soil. Tn916 was seen to transfer in sterile soil at a frequency of 2.1 x 10^-5 and in native soil at a frequency of 6.18 x 10^-5.

Enterococcus matings. To examine the, ability of Tn916 to enter the soil population, it was of interest to use a Tn916-donor that may be commonly introduced into the soil ecosystem. Present fertilization practices allow fecal material with high concentrations of intestinal microorganisms to be deposited onto agronomic soils. Therefore, in addition to Bacillus interspecies matings, additional matings were performed using E. faecalis (AP-2), a common inhabitant of mammalian fecal material, as the donor. The recipient remained B. thuringiensis AN142 as in previous matings. Under standard conditions, Tn916 was shown to transfer from E. faecalis at a frequency of 2.3 x 10^-6 conjugants per donor.

Tetracycline resistance from swine wastes. Concentrations of culturable organisms, tetracycline resistant organisms, enterococci and tetracycline resistant enterococci in farrowing house wastes were determined by differential plate counts. These results are summarized in Table 1. The total culturable bacteria in the outflow sample was determined to be 5.5 x 10⁷ CFU/ml on BHI agar. Of the total bacteria cultured, 1.6 x 10⁷ CFU/ml or 29% were tetracycline resistant. The total concentration of enterococci was determined to be 2.9 x 10⁵ CFU/ml. Although this represented only a small portion of the total cultured organisms, 2.1 x 10⁵ CFU/ml or 71 % of the total enterococci were resistant to tetracycline.

Conjugal activity in swine wastes. One hundred tetracycline-resistant isolates were screened for conjugal transfer of Tet^r into B. thuringiensis. In the microassay, 34 of the 100 isolates were found to possess a conjugal tetracycline resistance gene. A group of 10 conjugation-positive isolates and 2 conjugation-negative isolates were mated with B. thuringiensis AN142 by the conventional mating protocol of Naglich and Andrews (1987) to determine frequencies of transfer (Table 2). The conjugation-negative isolates showed no detectable transfer of the tetracycline resistant phenotype to the recipient.

To assess the ability of the conjugal elements to transfer within the soil environment, the 10 conjugal isolates and 2 conjugation negative isolates were mated in a laboratory soil microcosm. The tetracycline resistance was seen to transfer from the Enterococcus donor to a B. thuringiensis AN142 recipient at nearly the same frequency as was seen for Tn916 soil transfer from CG110 (Table 3). Transfer of tetracycline resistance from the nonconjugal isolates was not observed.

Mobilization of plasmid DNA is an important aspect of the conjugal activities of Tn916. Therefore, to detect this ability among the conjugal elements isolated here, the 10 elements were moved into a B. subtilis strain with pC194. When these strains were mated with the AN142 recipient, plasmid transfer was detected in all cases. The presence of the plasmid in the conjugants was confirmed by DNA extraction and visualization on an agarose gel (data not shown).

Southern hybridization of blotted conjugant genomic DNA, arising from filter matings between enterococcal isolates and B. thuringiensis AN142, was performed. The results revealed extensive homology between the pAM120 probe (Tn916) and an element within the conjugant genome. Moreover, restriction digestion with HincII showed the conjugant had obtained an element with approximately the same restriction pattern as Tn916 (Fig. 5). Hybridization with DNA extracted from AN142 showed no hybridization to the probe used.

The internal sequence of the Tn916-like elements was further examined by an application of PCR. When the amplification was performed on the 10 conjugant strains analyzed above, the results showed a band of approximately 715 bp present in all strains tested (Fig. 6). The same band was visible when the amplification was performed on pAM120 (Tn916) and on a conjugant arising from a mating with CG110. No amplification was seen in a genomic extract of B. thuringiensis AN142.

DISCUSSION

The enterococci were chosen for this work because they have been shown to possess many conjugal resistance genes (2). Furthermore, because the deposition of animal fecal material containing high numbers of enterococci, as well as other enteric organisms, on agronomic soils is a common practice to increase soil fertility, this may be a method for the introduction of conjugal genes into the environment. Studies have shown the ability of conjugal elements to transfer between organisms in the soil (15). The work presented here confirms the presence of conjugal resistance genes in the swine facility outflow. Depositing of the effluence onto the soil may provide the necessary cell contact with recipients to allow conjugal elements to move into the soil microflora.

Of the total cultured bacteria from the effluence, 29% showed resistance to tetracycline. In this farrowing house, tetracycline was not used in the feed (D. Zimmerman, Department of Animal Science, Iowa State University). Therefore, there was no selection for tetracycline resistant organisms in the waste material. The experiments shown herein, however, show that some resistance determinants persist in populations, even without selective pressure (10). Naglich and Andrews

(1987) showed that Tn916 is extremely stable in the absence of selection. For these reasons, numbers of tetracycline resistant organisms in the population may remain high. More interesting is the high level of resistance among the Enterococcus population. Clearly, there is a significant population of resistant enterococci present in the swine herds tested. These results are strengthened by data from Knudtson and Hartman (7) who found 88% tetracycline resistance among enterococcal isolates from swine carcasses at the time of slaughter. Furthermore, these findings are paralleled by those obtained for enterococcal isolations from human sewage sources, showing 29% of E. faecalis isolates to possess a conjugal tetracycline resistance gene (data not shown). Finally, even though data presented herein show 71% of the Enterococcus population in the swine effluence to be resistant to tetracycline, these enterococci represent only 1% of the total tetracycline resistance within the culturable population. Therefore, the major portion of the resistant population has yet to be studied.

The hybridization of the pAM120 probe to genomic extracts from conjugants, shows that the elements found in the farrowing house wastes to share homology with Tn916. Plasmid extracts from the B. thuringiensis conjugants were unable to detect the acquisition of any new plasmids by these populations. Furthermore, in undigested samples of DNA from conjugants, the pAM120 probe was seen to hybridize to the chromosomal band upon visualization by autoradiography (data not shown). Taken together, these data indicate the likelihood of a chromosome-borne conjugal element.

Homology between the Tn916-like elements and Tn916 is further shown in the PCR results. The primers for the amplification were specifically designed to amplify a sequence within ORF 13. This sequence was chosen due to previous data that show this open reading frame to be essential for conjugation, but not intracellular transposition (Loe and Andrews, unpublished data). This would, therefore, be an ideal sequence to use for the detection of conjugal elements. As evidence, this sequence was found within every Enterococcus isolate tested that possessed a conjugal tetracycline resistance gene. The sequence was not detected in strains from which transfer of tetracycline resistance was not observed.

Thus, the results presented herein clearly show the presence of conjugal elements with homology to Tn916 in the Enterococcus population of swine lot effluence. Furthermore, because the effluence is distributed on agronomic soils, the opportunity for transfer of the resistant phenotype is created. When the isolates were tested in laboratory soil microcosms, transfer of the tetracycline resistant phenotype was detected at frequencies near those for Tn916. Furthermore, because the recipient was a Bacillus sp., these elements have the ability to transfer resistance genes across genus lines. Although elements with sequence homology to Tn916 have been found before (1), the demonstration of high numbers of these elements capable of cross genus transfer in a soil environment is novel.

REFERENCES

Bentorcha, F., D. Clermont, G. de Cespedes, and T. Horaud. 1992. Natural occurrence of structures in oral streptococci and enterococci with homology to Tn916. Antimicrob. Agents Chemother. 36:59-63.

Clewell, D.B. 1990. Movable genetic elements and antibiotic resistance in enterococci. Eur. J. of Clin. Microbiol. Infect. Dis. 9:90-102.

Flannagan, S.E., L.A. Zitzow, Y.A. Su and D.B. Clewell. 1994. Nucleotide sequence of the 18-kb conjugative transposon Tn916 from Enterococcus faecalis. Plasmid 32:350-354.

Franke, A.E. and D.B. Clewell. 1981. Evidence for a chromosome-borne resistance transposon (Tn916) in Streptococcus faecalis that is capable of "conjugal" transfer in the absence of a conjugative plasmid. J. Bacteriol. 145:494-502.

Gawron-Burke, C. and D.B. Clewell. 1982. A transposon in Streptococcus faecalis with fertility properties. Nature 300:281-284.

Knudtson, L.M. and P.A. Hartman. 1992. Routine procedures for isolation and identification of enterococci and fecal streptococci. Appl. and Environ. Microbiol. 58:3027-3031.

Knudtson, L.M. and P.A. Hartman. 1993. Antibiotic resistance among enterococcal isolates from environmental and clinical sources. J. of Food Prot. 56:489-492.

Krasovsky V.N. and G. Stotzky. 1987. Conjugation and genetic recombination in Escherichia coli in sterile and nonsterile soil. Soil Biol. and Biochem. 19: 631-638.

Maniatis, T., E.F. Fritsch and J. Sambrook. 1982. Molecular Cloning: A Laboratory Manual, 2nd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.

Naglich, J.G. and R.E. Andrews Jr. 1988a. Introduction of the Streptococcus faecalis transposon Tn916 into Bacillus thuringiensis subsp. israelensis. Plasmid 19:84-93.

Naglich, J.G. and R.E. Andrews Jr. 1988b. Tn916-dependent conjugal transfer of pC194 and pUB110 from Bacillus subtilis into Bacillus thuringiensis subsp. israelensis. Plasmid 20:113-126.

Natarajan M.R. and P. Oriel. 1992. Transfer of transposon Tn916 from Bacillus subtilis into a natural soil population. Appl. and Environ. Microbiol. 58: 2701-2703.

Showsh S.A. and Andrews R.E. Jr. 1992. Tetracycline enhances Tn916-mediated conjugal transfer. Plasmid 28: 213-224.

Southern, E.M. 1975. Detection of specific sequences among DNA fragments separated by gel electrophoresis. J. of Mol. Biol. 98:503-517.

Stotzky G. and H. Babich. 1986. Survival of, and genetic transfer by, genetically engineered bacteria in natural environments. Adv. in Appl. Microbiol. 31:93-138.

Torres, O.R., R.Z. Korman, S.A. Zahler and G.M. Dunny. 1991. The conjugative transposon Tn925 - enhancement of conjugal transfer by tetracycline in Enterococcus faecalis and mobilization of chromosomal genes in Bacillus subtilis and E. faecalis. Mol. Gen. Genet. 225:395-400.

van Elsas J.D., Govaert J.M. and Johannes A.V. 1987. Transfer of plasmid pTF30 between bacilli in soil as influenced by bacterial population dynamics and soil conditions. Soil Biol. Biochem. 19: 639-647.

van Elsas, J.D. 1992. Antibiotic resistance gene transfer in the environment: an overview, In: E.M.H. Wellington and J.D. van Elsas ed., Genetic Interactions Among Microorganisms in the Natural Environment, pp. 17-39. Pergamon Press Limited, Headington Hill Hall, Oxford.

Table 1. Bacterial populations occuring in a swine lot effluence sample from the Iowa State University swine farrowing house, as determined by differential plate count.

Population	Culturable CFU/mla
Total bacteria	5.5 x 107
Total Tetr bacteria	1.6 x 107
Total enterococci	2.9 x 107
Tetr enterococci	2.1 x 107

^aDetermined by dilution and pour plates with differential media as explained in Materials and Methods
^bTet^r = tetracycline resistant (10 µg/ml)

Table 2. Comparison of conjugal microassay and conventional mating for the detection of conjugation.

Isolate	Microassaya	Transfer frequencyb	Standard deviation
CG110c	(+)	3.73 x 10-6	3.73 x 10-6
AH1-7	(+)	1.23 x 10-6	1.23 x 10-6
AH2-8	(+)	2.23 x 10-6	2.23 x 10-6
AH2-13	(+)	1.31 x 10-6	1.31 x 10-6
AH2-17	(+)	9.62 x 10-6	9.62 x 10-6
AH3-13	(+)	3.24 x 10-6	3.24 x 10-6
AH4-6	(+)	3.11 x 10-6	3.11 x 10-6
AH4-8	(+)	2.34 x 10-6	2.34 x 10-6
AH4-10	(+)	2.43 x 10-6	2.43 x 10-6
AH4-14	(+)	6.40 x 10-6	6.40 x 10-6
AH4-17	(+)	6.25 x 10-6	6.25 x 10-6
AH1-21	(-)	NDd
AH2-21	(-)	NDd

^aConjugal activity determined by the microassay presented herein.
^bFrequency of conjugants/output donor determined by conventional mating procedure (Naglich and Andrews, 1988). Entry represents mean of three independent matings.
^cPositive control: E. faecalis (Chr::Tn916).
^dND = not detected.

Table 3. Transfer frequencies for Tn916-like conjugal elements between enterococci and B. thuringiensis AN142 in soil.

Isolate	Transfer frequencya	Standard deviation
CG110b	4.14 x 10-6	1.07 x 10-6
AH1-7	1.00 x 10-6	3.53 x 10-7
AH2-8	9.09 x 10-7	2.09 x 10-7
AH2-13	7.69 x 10-7	1.33 x 10-7
AH2-17	9.09 x 10-7	2.32 x 10-7
AH3-13	6.90 x 10-7	1.49 x 10-7
AH4-6	1.25 x 10-6	2.39 x 10-7
AH4-8	1.17 x 10-6	1.00 x 10-7
AH4-10	1.25 x 10-6	1.82 x 10-7
AH4-14	1.14 x 10-6	1.51 x 10-7
AH4-17	7.35 x 10-7	1.89 x 10-7
AH1-21	NDc
AH2-21	NDc

^aFrequency of conjugants/output donor determined by soil mating procedure (Haack and Andrews, in press). Entry represents mean of three independent matings.
^bPositive control: E. faecalis (Chr::Tn916).
^cND = not detected.

Figure 1. The effect of soil moisture on conjugal transposition of Tn916. The soil was first sterilized, then sterile water was added to obtain the appropriate soil moisture. Before donors (B. subtilis AN861) and recipients (B. thuringiensis AN142) were added to the mixture, samples were allowed to equilibrate for 24 h.

Figure 2. The effect of nutrients on conjugal transposition of Tn916 in soil. Soil moisture was adjusted to 7.5% as described in the Materials and Methods, then BHI was added to the appropriate concentration. Donors (B. subtilis AN861) and recipients (B. thuringiensis AN 142) were added to the mixture, then incubated overnight.

Figure 3. Effect of temperature on conjugal transfer of Tn916 in soil. Donors (B. subtilis AN861) and recipients (B. thuringiensis AN142) were added to the mixture and the mixture was incubated overnight at the indicated temperature.

Figure 4. The effect of soil pH on conjugal transfer of Tn916. The pH of the soil mixture was adjusted as described (see Materials and Methods) and donors (B. subtilis AN861) and recipients (B. thuringiensis AN142) were added to the mixture. Overnight incubation was at 30C.

Figure 5. Southern hybridization analysis of DNA extracted from conjugants arising from matings with E. faecalis containing Tn916-like elements. DNA extracts were digest with HincII prior to gel electrophoresis. Left Panel: Ethidium bromide-stained 0.8% agarose gel of HincII-digested conjugant DNA. Right Panel: Southern hybridization analysis of blotted DNA from gel with ³²P-labeled pAM120 (Tn916). (Lane M) HindII-digested lambda DNA. (Lane 1) HincII-digested pAM120; (Lane 2) B. thuringiensis AN142; (Lanes 3 - 6) HincII- digest DNA extracted from conjugants from matings with E. faecalis isolates containing Tn916-like elements. [A polaroid photograph of the gel and the resulting autoradiogram were each digitized by a ScanMaker IIXE flatbed image scanner (Microtek Lab., Inc., Redondo Beach, CA) and Adobe Photoshop (Adobe Systems Inc., Mountain View, CA.)].

Figure 6. Ethidium bromide-stained 0.8% agarose gel of PCR amplified DNA from conjugant DNA extracts. (Lane 1) 100 bp DNA ladder; (Lane 2) B. thuringiensis AN142; (Lane 3) pAM120 (Tn916); (Lane 4) conjugant from mating with E. faecalis AP-2 (Chr::Tn916); (Lanes 5-12) conjugants from matings with E. faecalis isolates containing Tn916-like elements; (Lane 13) positive control, 500 bp lambda DNA amplification. [A polaroid photograph of the gel was digitized by a ScanMaker IIXE flatbed image scanner (Microtek Lab., Inc., Redondo Beach, CA) and Adobe Photoshop (Adobe Systems Inc., Mountain View, CA.)].